Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 489477
End position: 489500
Length: 24

DNA sequence
>NC_010617, from 489477 to 489500 (24 bp); Kocuria rhizophila DC2201 CCGCGTCCGTGTCCGCGGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 486719-489733	Sequence	KRH_04470 - putative FAD linked oxidase (Protein is coded in complementary strand; from 489733 to 486719)