Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 470017
End position: 470040
Length: 24

DNA sequence
>NC_010617, from 470017 to 470040 (24 bp); Kocuria rhizophila DC2201 GTCCGGGTCGGGGTCCGTGTCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 469586-470740	Sequence	KRH_04310 - two-component histidine kinase (Protein is coded in complementary strand; from 470740 to 469586)