Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 414852
End position: 414876
Length: 25

DNA sequence
>NC_010617, from 414852 to 414876 (25 bp); Kocuria rhizophila DC2201 GGCCAGGCCCGGCCCGCCCAGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 414307-415623	Sequence	KRH_03760 - putative sugar ABC transporter sugar-binding protein (Protein is coded in complementary strand; from 415623 to 414307)