Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 392934
End position: 392978
Length: 45

DNA sequence
>NC_010617, from 392934 to 392978 (45 bp); Kocuria rhizophila DC2201 GCCGAGGCGTCGGGATCCGAGGCCTCGTGAGCCGAGGCGCGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 392118-393197	Sequence	KRH_03550 - hypothetical protein (Protein is coded in complementary strand; from 393197 to 392118)