Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 331474
End position: 331500
Length: 27

DNA sequence
>NC_010617, from 331474 to 331500 (27 bp); Kocuria rhizophila DC2201 CCAGCACCACCTGCACCAGCAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 331209-332546	Sequence	KRH_03010 proP proline/betaine transporter (Protein is coded in complementary strand; from 332546 to 331209)