Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2352594
End position: 2352617
Length: 24

DNA sequence
>NC_010617, from 2352594 to 2352617 (24 bp); Kocuria rhizophila DC2201 GCCACGGCCACGGCCATGGCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2352150-2352881	Sequence	KRH_20480 - hypothetical protein (Protein is coded in complementary strand; from 2352881 to 2352150)