Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2264415
End position: 2264468
Length: 54

DNA sequence
>NC_010617, from 2264415 to 2264468 (54 bp); Kocuria rhizophila DC2201 GTTCGGCATTGTCAGGGCGTTCGGCTTTCTCGGGGCGTTCGGCGGTGTCAGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2264369-2265604	Sequence	KRH_19690 - hypothetical protein (Protein is coded in complementary strand; from 2265604 to 2264369)