Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2263449
End position: 2263481
Length: 33

DNA sequence
>NC_010617, from 2263449 to 2263481 (33 bp); Kocuria rhizophila DC2201 GCGCCGCGTCAGCACGGCGTCAGCGCTGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2263480-2264376	Sequence	KRH_19680 - putative esterase (Protein is coded in complementary strand; from 2264376 to 2263480)