Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2210025
End position: 2210048
Length: 24

DNA sequence
>NC_010617, from 2210025 to 2210048 (24 bp); Kocuria rhizophila DC2201 CCACGGCCAGGGCCACGCCCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2209898-2210449	Sequence	KRH_19230 - hypothetical protein (Protein is coded in complementary strand; from 2210449 to 2209898)