Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2104231
End position: 2104266
Length: 36

DNA sequence
>NC_010617, from 2104231 to 2104266 (36 bp); Kocuria rhizophila DC2201 GACGATGCGCTCCACGATCCGCTCGACCGTGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2103416-2104597	Sequence	KRH_18480 fruK putative 1-phosphofructokinase (Protein is coded in complementary strand; from 2104597 to 2103416)