Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 204751
End position: 204774
Length: 24

DNA sequence
>NC_010617, from 204751 to 204774 (24 bp); Kocuria rhizophila DC2201 CGACCACGGCCACGCCCACGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 204135-205160	Sequence	KRH_01860 - hypothetical protein (Protein is coded in complementary strand; from 205160 to 204135)