Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2030497
End position: 2030532
Length: 36

DNA sequence
>NC_010617, from 2030497 to 2030532 (36 bp); Kocuria rhizophila DC2201 CCTGCACCGCCTCCTTCACCACCTCCTGGAACGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2029791-2030906	Sequence	KRH_17890 manC mannose-1-phosphate guanylyltransferase (Protein is coded in complementary strand; from 2030906 to 2029791)