Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 2012672
End position: 2012707
Length: 36

DNA sequence
>NC_010617, from 2012672 to 2012707 (36 bp); Kocuria rhizophila DC2201 GTGCTTCTCCTCGAGCTTCTCCTCGAGCTTCTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2012616-2013983	Sequence	KRH_17740 - hypothetical protein (Protein is coded in complementary strand; from 2013983 to 2012616)