Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1978711
End position: 1978734
Length: 24

DNA sequence
>NC_010617, from 1978711 to 1978734 (24 bp); Kocuria rhizophila DC2201 GGGGCGGGTGCGGGGGCCGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1978567-1979457	Sequence	KRH_17430 - hypothetical protein (Protein is coded in complementary strand; from 1979457 to 1978567)