Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1969643
End position: 1969666
Length: 24

DNA sequence
>NC_010617, from 1969643 to 1969666 (24 bp); Kocuria rhizophila DC2201 TGCGGCGGCGGCTGCCGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1968339-1969787	Sequence	KRH_17360 rnr putative ribonuclease R (Protein is coded in complementary strand; from 1969787 to 1968339)