Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1958679
End position: 1958705
Length: 27

DNA sequence
>NC_010617, from 1958679 to 1958705 (27 bp); Kocuria rhizophila DC2201 TCCTTGAACTCCTTGATCTCCGTGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957725-1959200	Sequence	KRH_17250 glmU UDP-N-acetylglucosamine pyrophosphorylase/glucosamine-1-phosphate N-acetyltransferase (Protein is coded in complementary strand; from 1959200 to 1957725)