Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1921806
End position: 1921829
Length: 24

DNA sequence
>NC_010617, from 1921806 to 1921829 (24 bp); Kocuria rhizophila DC2201 TCAGGGCCAGGGTCACGGCCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1921403-1921822	Sequence	KRH_16960 - hypothetical protein (Protein is coded in complementary strand; from 1921822 to 1921403)