Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1886445
End position: 1886474
Length: 30

DNA sequence
>NC_010617, from 1886445 to 1886474 (30 bp); Kocuria rhizophila DC2201 GCCGACTCCGACGCCGCCGCCCACGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1885681-1886565	Sequence	KRH_16650 - putative ABC transporter ATP-binding protein