Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1839250
End position: 1839273
Length: 24

DNA sequence
>NC_010617, from 1839250 to 1839273 (24 bp); Kocuria rhizophila DC2201 TCGTCCTCGCCCACGTCCCCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1839148-1839705	Sequence	KRH_16220 frr ribosome recycling factor (Protein is coded in complementary strand; from 1839705 to 1839148)