Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1798218
End position: 1798265
Length: 48

DNA sequence
>NC_010617, from 1798218 to 1798265 (48 bp); Kocuria rhizophila DC2201 TCAGAACGCTGGGTGCTCGGAACTCCGGGTGCTCAGAACGCCGGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1798251-1799357	Sequence	KRH_15840 recA RecA protein (Protein is coded in complementary strand; from 1799357 to 1798251)