Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1762140
End position: 1762163
Length: 24

DNA sequence
>NC_010617, from 1762140 to 1762163 (24 bp); Kocuria rhizophila DC2201 ACGTCCACGGCCACGGCCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1761045-1762250	Sequence	KRH_15490 argG argininosuccinate synthase (Protein is coded in complementary strand; from 1762250 to 1761045)