Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1670566
End position: 1670592
Length: 27

DNA sequence
>NC_010617, from 1670566 to 1670592 (27 bp); Kocuria rhizophila DC2201 CAGGAAGTCCGGGAAGTCCAGGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1670561-1671811	Sequence	KRH_14790 ftsZ cell division protein FtsZ (Protein is coded in complementary strand; from 1671811 to 1670561)