Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1573549
End position: 1573578
Length: 30

DNA sequence
>NC_010617, from 1573549 to 1573578 (30 bp); Kocuria rhizophila DC2201 GTCGTCGTCATCGTCGTCCTCGTCGTAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1573439-1573801	Sequence	KRH_13940 - hypothetical protein (Protein is coded in complementary strand; from 1573801 to 1573439)