Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1556499
End position: 1556522
Length: 24

DNA sequence
>NC_010617, from 1556499 to 1556522 (24 bp); Kocuria rhizophila DC2201 ACCACGAGCACGACCACCACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1556280-1557092	Sequence	KRH_13790 tatC Sec-independent protein translocase TatC (Protein is coded in complementary strand; from 1557092 to 1556280)