Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1506492
End position: 1506521
Length: 30

DNA sequence
>NC_010617, from 1506492 to 1506521 (30 bp); Kocuria rhizophila DC2201 CACGGCCACCGCCTCGGCCACGGCCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1506400-1506816	Sequence	KRH_13380 nusB antitermination factor NusB (Protein is coded in complementary strand; from 1506816 to 1506400)