Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1464268
End position: 1464291
Length: 24

DNA sequence
>NC_010617, from 1464268 to 1464291 (24 bp); Kocuria rhizophila DC2201 CTTGTCCTTGCCGTTGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1464260-1466116	Sequence	KRH_13050 lepA GTP-binding protein LepA (Protein is coded in complementary strand; from 1466116 to 1464260)