Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1365003
End position: 1365029
Length: 27

DNA sequence
>NC_010617, from 1365003 to 1365029 (27 bp); Kocuria rhizophila DC2201 GCACGGCGAGCACGGCGAGCACGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1364612-1365406	Sequence	KRH_12230 - putative ABC transporter permease (Protein is coded in complementary strand; from 1365406 to 1364612)