Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1353076
End position: 1353099
Length: 24

DNA sequence
>NC_010617, from 1353076 to 1353099 (24 bp); Kocuria rhizophila DC2201 CGGCGGCCGCGGCGTCGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1352664-1353452	Sequence	KRH_12140 pgl 6-phosphogluconolactonase (Protein is coded in complementary strand; from 1353452 to 1352664)