Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 1103800
End position: 1103823
Length: 24

DNA sequence
>NC_010617, from 1103800 to 1103823 (24 bp); Kocuria rhizophila DC2201 CAGCAGCACCAGCAGGAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1103381-1104583	Sequence	KRH_10140 - hypothetical protein (Protein is coded in complementary strand; from 1104583 to 1103381)