Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 972505
End position: 972532
Length: 28

DNA sequence
>NC_010571, from 972505 to 972532 (28 bp); Opitutus terrae PB90-1 AGTTGAGAGTTGAGCGTTGAGGGTTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 971557-972963	Sequence	Oter_0796 - RNA modification protein (Protein is coded in complementary strand; from 972963 to 971557)