Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 971087
End position: 971110
Length: 24

DNA sequence
>NC_010571, from 971087 to 971110 (24 bp); Opitutus terrae PB90-1 TTCTCTTACTCTTTCTCGTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 971111-971515	Sequence	Oter_0795 - S23 ribosomal protein (Protein is coded in complementary strand; from 971515 to 971111)