Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 923038
End position: 923061
Length: 24

DNA sequence
>NC_010571, from 923038 to 923061 (24 bp); Opitutus terrae PB90-1 GCGAGCGCGAGGGCCAGCGCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 922612-924051	Sequence	Oter_0755 - proton-translocating NADH-quinone oxidoreductase subunit N