Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 893115
End position: 893142
Length: 28

DNA sequence
>NC_010571, from 893115 to 893142 (28 bp); Opitutus terrae PB90-1 GGCCACCGGCCACACGCCACCGGCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 892708-893835	Sequence	Oter_0724 - glucose--fructose oxidoreductase (Protein is coded in complementary strand; from 893835 to 892708)