Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5868188
End position: 5868211
Length: 24

DNA sequence
>NC_010571, from 5868188 to 5868211 (24 bp); Opitutus terrae PB90-1 CGACCGCGAACGCGAGCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5867518-5869671	Sequence	Oter_4567 - O-antigen polymerase (Protein is coded in complementary strand; from 5869671 to 5867518)