Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5866487
End position: 5866510
Length: 24

DNA sequence
>NC_010571, from 5866487 to 5866510 (24 bp); Opitutus terrae PB90-1 TGCTGCTGCTGTTGTTGCTCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5866397-5867506	Sequence	Oter_4566 - hypothetical protein (Protein is coded in complementary strand; from 5867506 to 5866397)