Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5639622
End position: 5639654
Length: 33

DNA sequence
>NC_010571, from 5639622 to 5639654 (33 bp); Opitutus terrae PB90-1 CGTCCGCCCGCCGGCCGCGCGCGGTCTGCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5638706-5639701	Sequence	Oter_4345 - ribonuclease BN (Protein is coded in complementary strand; from 5639701 to 5638706)