Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5625371
End position: 5625400
Length: 30

DNA sequence
>NC_010571, from 5625371 to 5625400 (30 bp); Opitutus terrae PB90-1 GTGCCAGCGCGTGCCGCCGCCGGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5625228-5627216	Sequence	Oter_4336 - alpha-N-arabinofuranosidase (Protein is coded in complementary strand; from 5627216 to 5625228)