Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5518474
End position: 5518497
Length: 24

DNA sequence
>NC_010571, from 5518474 to 5518497 (24 bp); Opitutus terrae PB90-1 GGTGGCGGTCGCGGTGGTGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5515316-5518591	Sequence	Oter_4266 - TonB-dependent receptor plug (Protein is coded in complementary strand; from 5518591 to 5515316)