Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5501066
End position: 5501089
Length: 24

DNA sequence
>NC_010571, from 5501066 to 5501089 (24 bp); Opitutus terrae PB90-1 CACCGCCACCACCGCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5493697-5502105	Sequence	Oter_4251 - Ig family protein (Protein is coded in complementary strand; from 5502105 to 5493697)