Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5401336
End position: 5401360
Length: 25

DNA sequence
>NC_010571, from 5401336 to 5401360 (25 bp); Opitutus terrae PB90-1 GCCGCGCTGCGCCGGGCCTCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5398838-5401402	Sequence	Oter_4175 - TPR repeat-containing serine/threonine protein kinase