Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5366126
End position: 5366149
Length: 24

DNA sequence
>NC_010571, from 5366126 to 5366149 (24 bp); Opitutus terrae PB90-1 CGCGCTCGCGTTCGCGCTCGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5365870-5366760	Sequence	Oter_4149 - binding-protein-dependent transport system inner membrane protein