Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5318833
End position: 5318856
Length: 24

DNA sequence
>NC_010571, from 5318833 to 5318856 (24 bp); Opitutus terrae PB90-1 TCAGCGGCAGCGTCAGCTTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5318556-5319284	Sequence	Oter_4106 - hypothetical protein (Protein is coded in complementary strand; from 5319284 to 5318556)