Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5256899
End position: 5256952
Length: 54

DNA sequence
>NC_010571, from 5256899 to 5256952 (54 bp); Opitutus terrae PB90-1 TTTCTCCTCCTCGTTCTCTTTCTCGTTCTCGTTCTCATTCTCTTTCTCGTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5253550-5256900	Sequence	Oter_4053 - DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 5256900 to 5253550)