Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 5246484
End position: 5246511
Length: 28

DNA sequence
>NC_010571, from 5246484 to 5246511 (28 bp); Opitutus terrae PB90-1 CGCTCAACCCTCAACGCTCAACCCTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5246495-5247907	Sequence	Oter_4045 - argininosuccinate lyase (Protein is coded in complementary strand; from 5247907 to 5246495)