Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 4972570
End position: 4972599
Length: 30

DNA sequence
>NC_010571, from 4972570 to 4972599 (30 bp); Opitutus terrae PB90-1 GCCAGCTGGCGCCAGCCGGCGCCAGCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4972462-4974915	Sequence	Oter_3828 - family 1 glycoside hydrolase (Protein is coded in complementary strand; from 4974915 to 4972462)