Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 4914051
End position: 4914074
Length: 24

DNA sequence
>NC_010571, from 4914051 to 4914074 (24 bp); Opitutus terrae PB90-1 TCACCGCTTCACCGTTTCACCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4914052-4915101	Sequence	Oter_3782 - glycoprotease family metalloendopeptidase (Protein is coded in complementary strand; from 4915101 to 4914052)