Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 463137
End position: 463160
Length: 24

DNA sequence
>NC_010571, from 463137 to 463160 (24 bp); Opitutus terrae PB90-1 ACGCCGATGCCGATGCCGATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 462087-464102	Sequence	Oter_0384 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 464102 to 462087)