Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3866687
End position: 3866714
Length: 28

DNA sequence
>NC_010571, from 3866687 to 3866714 (28 bp); Opitutus terrae PB90-1 GAGAGTTGAGAGTTGAGGGTTGAGAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3866476-3868167	Sequence	Oter_3011 - N-6 DNA methylase (Protein is coded in complementary strand; from 3868167 to 3866476)