Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 366079
End position: 366102
Length: 24

DNA sequence
>NC_010571, from 366079 to 366102 (24 bp); Opitutus terrae PB90-1 CACCACCACCAGCAGCACGACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 366041-368032	Sequence	Oter_0314 - hypothetical protein (Protein is coded in complementary strand; from 368032 to 366041)