Sequence retrieval

Genome: Opitutus terrae PB90-1
Start position: 3620553
End position: 3620576
Length: 24

DNA sequence
>NC_010571, from 3620553 to 3620576 (24 bp); Opitutus terrae PB90-1 GAGCACGAGCAGGAACACGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3618904-3621798	Sequence	Oter_2835 - multi-sensor hybrid histidine kinase (Protein is coded in complementary strand; from 3621798 to 3618904)